Danza del vientre. Sombras del Desierto.

Aprende danza del vientre con un enfoque diferente, cultural y saludable. Bienvenido a Sombras del Desierto. Disfruta!

14/6/07

Zuel en Las mañanas de Cuatro

Las mañanas de Cuatro. Viernes 15 a las 11.15.
Canal Cuatro Televisión.
Actualidad, gente, sociedad, debates y mesas temáticas de la mano de Concha García Campoy.

Mañana la tertulia girará en torno al tema de los bailes eróticos y habrá una sorpresa en directo.
No os lo perdais!!

22 comentarios:

  1. Bailer eróticosfestivos guuuuaaaaaaaaauuuuuu pon la foto de tu caderita y la cara orgásmica esa que tanto nos gusta:):):):):)

    ResponderEliminar
  2. Anda Canaya... ya veo que al final tira lo que tira...
    En fin, solo cruzo los dedos porque se trate el tema con respeto. Lo cual no quita que pueda ser divertido...

    ResponderEliminar
  3. por dió por dió(wa llah wa llah)mañana es mi día D(depilación), pero tu tranki, que yo pongo la 4 y mientras me paso la "sil que pí" te veo.

    q ya q no te he visto bailar todavia,ahora encima te me pones a bailar en plan erótico,kiyoooo q me va a dá argo malo ,ajú ajú...

    pos yo como tus niñas de sevilla, kiero un shimmy tuyo...ea!

    espero q te salga tó mu bien y espero q a mi no me entren los calores al verte.

    Besiños

    La flor de Cai.

    ResponderEliminar
  4. Te entrarán, te entrarán barakalofi, jeje. Pues ale, a programar toooooos los videos. Enhorabuena salao, a ver ke tal.

    ResponderEliminar
  5. ¡¡Vaya horitas del programa!!

    ¿Y no hay una repeticion para trabajadoras matutinas?

    Bueno, confio en mi dvd y espero haberlo programado bien ajajaja

    Mucha suerteeeeee (aunque no la necesitas)

    ResponderEliminar
  6. que se dejen de tanto factor x, y que pongan al verdadero artista (farctor Z) jejejeeeee

    ResponderEliminar
  7. buaaahhh.... solo he visto la actuación, no la entrevista, y se la han cargao a base de primeros planos extremos de esos en los que sólo sale piel y no sabes qué se está moviendo. Las que no sois de Sevilla, nada: tenéis que verlo actuar en vivo.

    Eso sí, la cara de Anabel Alonso, impagable.

    ResponderEliminar
  8. qué guapisimo q estabas !

    esa mirada seductora...se me cayó la babilla...

    me ha encantao,mucha elegancia en tan pokito tiempo,se podían haber estirao un pokito,no?q llevaba desde las 11 pegá a Cuatro y hasta la 1 menos cuarto nada de nada,aissss,esa es la unica pega q le pongo.

    La cara de Mabel Lozano era pa foto.

    (y ya no digo ná de la parte donde la espalda pierde su nombre...q después creo polémica,...)

    Besitos

    (ahora solo me falta verte en directo)

    ResponderEliminar
  9. Qué pena!!me he perdido la Cara de Anabel Alonso como lo que me gusta esa actriz!!!qué guay ver las caritas deseosas de todas!!!:):):).
    Akí prima lo que prima y quien no lo reconozca es una mentirosa jajajajaja.
    Anita guapa, me alegro q estés mejor, te kiero un montón y lo sabes.
    HACEMOS UN DÚO GENIAL!!!QUÉ FUERTE!!QUÉ CONEXIÓN

    ResponderEliminar
  10. ¡¡Yo lo ví!! ¡¡Y presumí de profe a mis padres y amigos!! jijijiji
    Una pena que no te grabara en vídeo...¡estas para comertelo todo y no dejar ni las miguitas!
    ¡¡¡¡MUUUUACKSSSSS!!!!
    ¡Muchas Felicidades!
    Pero deberían haberte dejado más tiempo pa ti jiji


    Isabel Mebarak. Cádiz

    ResponderEliminar
  11. La cara de Anabel Alonso no era nada comparada con la mía cuando he llegado a casa y leido vuestros comentarios.
    Bueno, como el programa era subidito de tono lo dejaré pasar...
    Pero "relajarse" jajajaja. Ay cuanto os quiero yo con tanta guasaaaa

    ResponderEliminar
  12. leches, me lo he perdido... me acabo de enterar y son las 23 del viernes.
    A ver si un alma caritativa lo sube al youtuve (si zuel está de acuerdo)

    ResponderEliminar
  13. En primer lugar, me pareció muy mal que hubiera un espectáculo de danza oriental en semejante contexto de pornografía, donde una streeper enseña a hacer strep-tease a las contertulias y el ambiente era bastante vulgar.
    Pero Zuel se defendió muy bien ante las preguntas que le hicieron, que iban relacionadas con el tema sexual, pero en plan porno. Bravo por Zuel.
    Cero para los cámaras y cero para los presentadores.

    ResponderEliminar
  14. Nene, todas somos Anabel Alonso JAJAJAJAJAJAJAJAJA

    Al final te he visto solo una mijita, pero tenéis razón, los cámaras regular..na más que querían sacar carne jajajajaja

    Pero nada, niño....has impresionaooooooo.

    P.D. Mejorando lo presente, que bueno está el Gonzalo por dios....

    ResponderEliminar
  15. Voy a llamar a la policía para que pongan un control de hormonas o algo.
    Qué de multas pondrían por aquí.
    Estamos salidillas, no? Bueno, yo me incluyo jijiji.
    Ahora comprendo a los hombres cuando ven a una bailarina. Solo ven carne.
    A ver si damos ejemplo, nenas. jaja besitos para todas.

    ResponderEliminar
  16. Rita la cantaora17/6/07 13:22

    Por una vez estoy con cleo en opinión.

    ResponderEliminar
  17. jaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaajajjajajajajajja es verdad y a la inversa nos quejamos jajajajaja me orino toa

    ResponderEliminar
  18. Lo de salidillas no será por mí, no?
    JAJAJAJAJAJAJAJAJA

    ResponderEliminar
  19. JAJAJAJAJA, a mi tambien me pareció muy cortito la verdad, y podian haberte entrevistado un poco más. Yo me puse a gritar como una loca, MAMAAAAAAAAAAAAAAAAAAAAAAA mira mira, ke está Zu en la teleeeee, y a mi cuñada y mis hermanos, jajaja. Ke ilusión, pero........ es mi impresión, o se te veia cortaillo? Un abrazo enorme. Acuerdate de las viejas compañeras cuando seas famoso ehhhh, jijijijijijiji.

    ResponderEliminar
  20. JOOOOOOOOOOOOOOOOOO!!!!!!
    Yo no lo ví, ni me enteré, estaba en Cadiz!( Que preciosa tierra por cierto)
    Jo, sabes donde lo podemos ver?.
    Que arte tienes jodío!

    ResponderEliminar
  21. Me encantó!!!
    Pero tengo una duda, si en lugar de Zuel hubiese ido una bailarina, los comentarios serían los mismos?

    ResponderEliminar
  22. Holaa ¡

    Me encanto , saluditos a todos ¡ :)

    ResponderEliminar